Table 4

16S rRNA gene-targeted group specific primers per bacterial group/species used in this study
Target Primer sequence (5’-3’) Reference strains Annealing temp (°C) Reference
Bacteroidetes
Bacteroides-Prevotella-Porphyromonas spp. GGTGTCGGCTTAAGTGCCAT Bacteroides fragilis DSM 2151/LMG 10263 68 [31]
CGGA(C/T)GTAAGGGCCGTGC
Firmicutes
Staphylococcus spp. GCGATTGATGGTGATACG Staphylococcus aureus ATCC 29213 55 [29]
AGCCAAGCCTTFACGAACTAAAGC
Clostridium coccoides-Eubacterium rectale group (clostridial cluster XIV) CGGTACCTGACTAAGAAGC Ruminococcus productus DSM 2950/YIT 6141 55 [31]
AGTTT(C/T)ATTCTTGCGAACG
C. leptum group (clostridial cluster IV) GCACAAGCAGTGGAGT Faecalibacterium prausnitzii YIT 6174 50 [30]
TTCCTCCGTTTTGTCAA
Lactobacillus spp. AGCAGTAGGGAATCTTCCA Lactobacillus acidophilus LMG 9433 58 [31]
CACCGCTACACATGGAG
Actinobacteria
Bifidobacterium spp. TCGCGTC(C/T)GGTGTGAAAG Bifidobacterium longum DSM 20219/YIT 4021 58 [31]
CCACATCCAGC(A/G)TCCAC

Bervoets et al.

Bervoets et al. Gut Pathogens 2013 5:10   doi:10.1186/1757-4749-5-10

Open Data